gfp targeting shrna Search Results


90
Shanghai GenePharma lentiviral3-gfp-shrna specifically targeting maya
Lentiviral3 Gfp Shrna Specifically Targeting Maya, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lentiviral3-gfp-shrna specifically targeting maya/product/Shanghai GenePharma
Average 90 stars, based on 1 article reviews
lentiviral3-gfp-shrna specifically targeting maya - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Broad Institute Inc lentiviral shrna constructs targeting murine cyld and gfp
Lentiviral Shrna Constructs Targeting Murine Cyld And Gfp, supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lentiviral shrna constructs targeting murine cyld and gfp/product/Broad Institute Inc
Average 90 stars, based on 1 article reviews
lentiviral shrna constructs targeting murine cyld and gfp - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Novobio Scientific Inc the shrna-hif-1α targeting the human hif-1α gene (pad-gfp-shrna-hif-1α)
DPCs were transfected <t>with</t> <t>pAd-GFP-shRNA-HIF-1α</t> for 48 h. (A1: Fluorescence microscopy. A2: Inverted phase-contrast microscopy). DPCs were transfected with pAd-GFP for 48 h (B1: Fluorescence microscopy. B2: Inverted phase-contrast microscopy). The control group can be observed in (C1 and C2) (100 ×).
The Shrna Hif 1α Targeting The Human Hif 1α Gene (Pad Gfp Shrna Hif 1α), supplied by Novobio Scientific Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/the shrna-hif-1α targeting the human hif-1α gene (pad-gfp-shrna-hif-1α)/product/Novobio Scientific Inc
Average 90 stars, based on 1 article reviews
the shrna-hif-1α targeting the human hif-1α gene (pad-gfp-shrna-hif-1α) - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Shanghai GenePharma lentiviral vectors carrying gfp and either shrna targeting gpr171 mrna or a non-targeting control shrna
DPCs were transfected <t>with</t> <t>pAd-GFP-shRNA-HIF-1α</t> for 48 h. (A1: Fluorescence microscopy. A2: Inverted phase-contrast microscopy). DPCs were transfected with pAd-GFP for 48 h (B1: Fluorescence microscopy. B2: Inverted phase-contrast microscopy). The control group can be observed in (C1 and C2) (100 ×).
Lentiviral Vectors Carrying Gfp And Either Shrna Targeting Gpr171 Mrna Or A Non Targeting Control Shrna, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lentiviral vectors carrying gfp and either shrna targeting gpr171 mrna or a non-targeting control shrna/product/Shanghai GenePharma
Average 90 stars, based on 1 article reviews
lentiviral vectors carrying gfp and either shrna targeting gpr171 mrna or a non-targeting control shrna - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Broad Institute Inc lentivirus containing cd209a- or gfp-targeted shrna
(A) BL/6 and CBA BMDCs were differentiated in medium containing GM-CSF over 7 days. RNA was purified and gene expression was assessed by Affymetrix Mouse 1.0 ST Gene Array technology. Scatter plot shows log2-transformed gene expression. Arrow points to <t>CD209a.</t> (B) Genes with two fold or greater difference in expression between mouse strains with characterized biological function were selected for GO analysis. A functional profile for differentially expressed genes was obtained using the web-server g:Profiler. (C) PRRs with two fold or greater difference in expression by CBA vs. BL/6 DCs are shown. Bars represent means ± S.D. of two independent microarray chips for each strain. (D) CD209a expression by BMDCs from four individual CBA and BL/6 mice was determined by qRT-PCR (mRNA relative to GAPDH).
Lentivirus Containing Cd209a Or Gfp Targeted Shrna, supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lentivirus containing cd209a- or gfp-targeted shrna/product/Broad Institute Inc
Average 90 stars, based on 1 article reviews
lentivirus containing cd209a- or gfp-targeted shrna - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Genechem gfp-expressing shrna plasmids control shrna figl-1-targeted shrnas
The effects of FIGL-1 overexpression. (A) NIH-3T3 cells were transfected <t>with</t> <t>plasmids</t> to overexpress <t>GFP</t> or GFP-FIGL-1 for 24 h, serum-starved for 24 h to induce the formation of primary cilia, and stained for acetylated tubulin (Ac-tub, magenta), pericentrin (PCNT, red) and DNA (blue). Scale bar: 7.5 μm. (B) The percentage of ciliated NIH-3T3 cells is reduced by overexpression of FIGL-1. Error bars represent the standard deviation. (C) HEK293T cells overexpressing GFP were immunostained for pericentrin (PCNT, red) and DNA (blue). Scale bar: 10 μm. (D and E) HEK293T cells were transfected with a GFP-FIGL-1-expressing vector for 24 h and immunostained for pericentrin (PCNT, red) and DNA (blue). FIGL-1 at a low expression level colocalizes with pericentrin (panel D, scale bar: 5 μm), but no pericentrin staining is observed in cells with a high expression level of FIGL-1 (panel E, scale bar: 10 μm). (F) HEK293T cells overexpressing GFP-FIGL-1 were immunostained for centrin (red) and DNA (blue). Scale bar: 7.5 μm. (G) HEK293T cells overexpressing GFP-FIGL-1 were immunostained for CP110 (red) and DNA (blue). Scale bar: 10 μm.
Gfp Expressing Shrna Plasmids Control Shrna Figl 1 Targeted Shrnas, supplied by Genechem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gfp-expressing shrna plasmids control shrna figl-1-targeted shrnas/product/Genechem
Average 90 stars, based on 1 article reviews
gfp-expressing shrna plasmids control shrna figl-1-targeted shrnas - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Shanghai GenePharma pgphi/gfp/neo plasmid containing vegf shrna expression cassette (target 9 sequence: ggagtaccctgatgagatcga)
The effects of FIGL-1 overexpression. (A) NIH-3T3 cells were transfected <t>with</t> <t>plasmids</t> to overexpress <t>GFP</t> or GFP-FIGL-1 for 24 h, serum-starved for 24 h to induce the formation of primary cilia, and stained for acetylated tubulin (Ac-tub, magenta), pericentrin (PCNT, red) and DNA (blue). Scale bar: 7.5 μm. (B) The percentage of ciliated NIH-3T3 cells is reduced by overexpression of FIGL-1. Error bars represent the standard deviation. (C) HEK293T cells overexpressing GFP were immunostained for pericentrin (PCNT, red) and DNA (blue). Scale bar: 10 μm. (D and E) HEK293T cells were transfected with a GFP-FIGL-1-expressing vector for 24 h and immunostained for pericentrin (PCNT, red) and DNA (blue). FIGL-1 at a low expression level colocalizes with pericentrin (panel D, scale bar: 5 μm), but no pericentrin staining is observed in cells with a high expression level of FIGL-1 (panel E, scale bar: 10 μm). (F) HEK293T cells overexpressing GFP-FIGL-1 were immunostained for centrin (red) and DNA (blue). Scale bar: 7.5 μm. (G) HEK293T cells overexpressing GFP-FIGL-1 were immunostained for CP110 (red) and DNA (blue). Scale bar: 10 μm.
Pgphi/Gfp/Neo Plasmid Containing Vegf Shrna Expression Cassette (Target 9 Sequence: Ggagtaccctgatgagatcga), supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pgphi/gfp/neo plasmid containing vegf shrna expression cassette (target 9 sequence: ggagtaccctgatgagatcga)/product/Shanghai GenePharma
Average 90 stars, based on 1 article reviews
pgphi/gfp/neo plasmid containing vegf shrna expression cassette (target 9 sequence: ggagtaccctgatgagatcga) - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Genechem human shrna lentivirus labeled with gfp targeting sat1 (shsat1)
The effects of FIGL-1 overexpression. (A) NIH-3T3 cells were transfected <t>with</t> <t>plasmids</t> to overexpress <t>GFP</t> or GFP-FIGL-1 for 24 h, serum-starved for 24 h to induce the formation of primary cilia, and stained for acetylated tubulin (Ac-tub, magenta), pericentrin (PCNT, red) and DNA (blue). Scale bar: 7.5 μm. (B) The percentage of ciliated NIH-3T3 cells is reduced by overexpression of FIGL-1. Error bars represent the standard deviation. (C) HEK293T cells overexpressing GFP were immunostained for pericentrin (PCNT, red) and DNA (blue). Scale bar: 10 μm. (D and E) HEK293T cells were transfected with a GFP-FIGL-1-expressing vector for 24 h and immunostained for pericentrin (PCNT, red) and DNA (blue). FIGL-1 at a low expression level colocalizes with pericentrin (panel D, scale bar: 5 μm), but no pericentrin staining is observed in cells with a high expression level of FIGL-1 (panel E, scale bar: 10 μm). (F) HEK293T cells overexpressing GFP-FIGL-1 were immunostained for centrin (red) and DNA (blue). Scale bar: 7.5 μm. (G) HEK293T cells overexpressing GFP-FIGL-1 were immunostained for CP110 (red) and DNA (blue). Scale bar: 10 μm.
Human Shrna Lentivirus Labeled With Gfp Targeting Sat1 (Shsat1), supplied by Genechem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human shrna lentivirus labeled with gfp targeting sat1 (shsat1)/product/Genechem
Average 90 stars, based on 1 article reviews
human shrna lentivirus labeled with gfp targeting sat1 (shsat1) - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Shanghai GenePharma gfp-labeled recombinant lentiviruses shrna targeting yap
The effects of FIGL-1 overexpression. (A) NIH-3T3 cells were transfected <t>with</t> <t>plasmids</t> to overexpress <t>GFP</t> or GFP-FIGL-1 for 24 h, serum-starved for 24 h to induce the formation of primary cilia, and stained for acetylated tubulin (Ac-tub, magenta), pericentrin (PCNT, red) and DNA (blue). Scale bar: 7.5 μm. (B) The percentage of ciliated NIH-3T3 cells is reduced by overexpression of FIGL-1. Error bars represent the standard deviation. (C) HEK293T cells overexpressing GFP were immunostained for pericentrin (PCNT, red) and DNA (blue). Scale bar: 10 μm. (D and E) HEK293T cells were transfected with a GFP-FIGL-1-expressing vector for 24 h and immunostained for pericentrin (PCNT, red) and DNA (blue). FIGL-1 at a low expression level colocalizes with pericentrin (panel D, scale bar: 5 μm), but no pericentrin staining is observed in cells with a high expression level of FIGL-1 (panel E, scale bar: 10 μm). (F) HEK293T cells overexpressing GFP-FIGL-1 were immunostained for centrin (red) and DNA (blue). Scale bar: 7.5 μm. (G) HEK293T cells overexpressing GFP-FIGL-1 were immunostained for CP110 (red) and DNA (blue). Scale bar: 10 μm.
Gfp Labeled Recombinant Lentiviruses Shrna Targeting Yap, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gfp-labeled recombinant lentiviruses shrna targeting yap/product/Shanghai GenePharma
Average 90 stars, based on 1 article reviews
gfp-labeled recombinant lentiviruses shrna targeting yap - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Shanghai GenePharma gfp-labeled recombinant lentivirus shrna targeting yap (shyap-963)
The effects of FIGL-1 overexpression. (A) NIH-3T3 cells were transfected <t>with</t> <t>plasmids</t> to overexpress <t>GFP</t> or GFP-FIGL-1 for 24 h, serum-starved for 24 h to induce the formation of primary cilia, and stained for acetylated tubulin (Ac-tub, magenta), pericentrin (PCNT, red) and DNA (blue). Scale bar: 7.5 μm. (B) The percentage of ciliated NIH-3T3 cells is reduced by overexpression of FIGL-1. Error bars represent the standard deviation. (C) HEK293T cells overexpressing GFP were immunostained for pericentrin (PCNT, red) and DNA (blue). Scale bar: 10 μm. (D and E) HEK293T cells were transfected with a GFP-FIGL-1-expressing vector for 24 h and immunostained for pericentrin (PCNT, red) and DNA (blue). FIGL-1 at a low expression level colocalizes with pericentrin (panel D, scale bar: 5 μm), but no pericentrin staining is observed in cells with a high expression level of FIGL-1 (panel E, scale bar: 10 μm). (F) HEK293T cells overexpressing GFP-FIGL-1 were immunostained for centrin (red) and DNA (blue). Scale bar: 7.5 μm. (G) HEK293T cells overexpressing GFP-FIGL-1 were immunostained for CP110 (red) and DNA (blue). Scale bar: 10 μm.
Gfp Labeled Recombinant Lentivirus Shrna Targeting Yap (Shyap 963), supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gfp-labeled recombinant lentivirus shrna targeting yap (shyap-963)/product/Shanghai GenePharma
Average 90 stars, based on 1 article reviews
gfp-labeled recombinant lentivirus shrna targeting yap (shyap-963) - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Cyagen Biosciences active virus particles containing either erβ-targeting (experimental) or the gfp-targeting (control) shrna plasmids
The effects of FIGL-1 overexpression. (A) NIH-3T3 cells were transfected <t>with</t> <t>plasmids</t> to overexpress <t>GFP</t> or GFP-FIGL-1 for 24 h, serum-starved for 24 h to induce the formation of primary cilia, and stained for acetylated tubulin (Ac-tub, magenta), pericentrin (PCNT, red) and DNA (blue). Scale bar: 7.5 μm. (B) The percentage of ciliated NIH-3T3 cells is reduced by overexpression of FIGL-1. Error bars represent the standard deviation. (C) HEK293T cells overexpressing GFP were immunostained for pericentrin (PCNT, red) and DNA (blue). Scale bar: 10 μm. (D and E) HEK293T cells were transfected with a GFP-FIGL-1-expressing vector for 24 h and immunostained for pericentrin (PCNT, red) and DNA (blue). FIGL-1 at a low expression level colocalizes with pericentrin (panel D, scale bar: 5 μm), but no pericentrin staining is observed in cells with a high expression level of FIGL-1 (panel E, scale bar: 10 μm). (F) HEK293T cells overexpressing GFP-FIGL-1 were immunostained for centrin (red) and DNA (blue). Scale bar: 7.5 μm. (G) HEK293T cells overexpressing GFP-FIGL-1 were immunostained for CP110 (red) and DNA (blue). Scale bar: 10 μm.
Active Virus Particles Containing Either Erβ Targeting (Experimental) Or The Gfp Targeting (Control) Shrna Plasmids, supplied by Cyagen Biosciences, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/active virus particles containing either erβ-targeting (experimental) or the gfp-targeting (control) shrna plasmids/product/Cyagen Biosciences
Average 90 stars, based on 1 article reviews
active virus particles containing either erβ-targeting (experimental) or the gfp-targeting (control) shrna plasmids - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

Image Search Results


DPCs were transfected with pAd-GFP-shRNA-HIF-1α for 48 h. (A1: Fluorescence microscopy. A2: Inverted phase-contrast microscopy). DPCs were transfected with pAd-GFP for 48 h (B1: Fluorescence microscopy. B2: Inverted phase-contrast microscopy). The control group can be observed in (C1 and C2) (100 ×).

Journal: American Journal of Translational Research

Article Title: Deferoxamine enhances the migration of dental pulp cells via hypoxia-inducible factor 1α

doi:

Figure Lengend Snippet: DPCs were transfected with pAd-GFP-shRNA-HIF-1α for 48 h. (A1: Fluorescence microscopy. A2: Inverted phase-contrast microscopy). DPCs were transfected with pAd-GFP for 48 h (B1: Fluorescence microscopy. B2: Inverted phase-contrast microscopy). The control group can be observed in (C1 and C2) (100 ×).

Article Snippet: A recombinant adenovirus vector carrying the GFP, the shRNA-HIF-1α targeting the human HIF-1α gene (pAd-GFP-shRNA-HIF-1α), or the control adenovirus (pAd-GFP) were constructed by Novobio Biotechnology (Shanghai, China).

Techniques: Transfection, shRNA, Fluorescence, Microscopy

(A) BL/6 and CBA BMDCs were differentiated in medium containing GM-CSF over 7 days. RNA was purified and gene expression was assessed by Affymetrix Mouse 1.0 ST Gene Array technology. Scatter plot shows log2-transformed gene expression. Arrow points to CD209a. (B) Genes with two fold or greater difference in expression between mouse strains with characterized biological function were selected for GO analysis. A functional profile for differentially expressed genes was obtained using the web-server g:Profiler. (C) PRRs with two fold or greater difference in expression by CBA vs. BL/6 DCs are shown. Bars represent means ± S.D. of two independent microarray chips for each strain. (D) CD209a expression by BMDCs from four individual CBA and BL/6 mice was determined by qRT-PCR (mRNA relative to GAPDH).

Journal: Journal of immunology (Baltimore, Md. : 1950)

Article Title: CD209a Expression on Dendritic Cells is Critical for the Development of Pathogenic Th17 Cell Responses in Murine Schistosomiasis 1

doi: 10.4049/jimmunol.1400121

Figure Lengend Snippet: (A) BL/6 and CBA BMDCs were differentiated in medium containing GM-CSF over 7 days. RNA was purified and gene expression was assessed by Affymetrix Mouse 1.0 ST Gene Array technology. Scatter plot shows log2-transformed gene expression. Arrow points to CD209a. (B) Genes with two fold or greater difference in expression between mouse strains with characterized biological function were selected for GO analysis. A functional profile for differentially expressed genes was obtained using the web-server g:Profiler. (C) PRRs with two fold or greater difference in expression by CBA vs. BL/6 DCs are shown. Bars represent means ± S.D. of two independent microarray chips for each strain. (D) CD209a expression by BMDCs from four individual CBA and BL/6 mice was determined by qRT-PCR (mRNA relative to GAPDH).

Article Snippet: CBA BMDCs derived with rGM-CSF were infected with lentivirus containing CD209a- or GFP-targeted shRNA (RNAi Platform of the Broad Institute, Cambridge, MA).

Techniques: Purification, Gene Expression, Transformation Assay, Expressing, Functional Assay, Microarray, Quantitative RT-PCR

(A) CBA and BL/6 mice were infected with S. mansoni for 7 weeks. RNA was purified from whole spleen tissue of individual mice and CD209a expression was assessed by qRT-PCR (mRNA relative to GAPDH). Data are from one representative experiment of two. (B-J) Splenocytes were isolated from normal and 7-week infected CBA and BL/6 mice. Surface expression of CD209a was assessed by flow cytometric analysis. Splenocytes were additionally stained for cell subpopulation markers CD11c, CD19, Gr-1, and F4/80 (C-F). The percentage of each individual splenocyte subpopulation that expresses CD209a was assessed by separately gating for CD11c+, CD19+, Gr-1+, or F4/80+ cells (G-J). Data are from one representative experiment of three or four. *p<0.05, **p<0.01, ***p<0.001, NS = not significant.

Journal: Journal of immunology (Baltimore, Md. : 1950)

Article Title: CD209a Expression on Dendritic Cells is Critical for the Development of Pathogenic Th17 Cell Responses in Murine Schistosomiasis 1

doi: 10.4049/jimmunol.1400121

Figure Lengend Snippet: (A) CBA and BL/6 mice were infected with S. mansoni for 7 weeks. RNA was purified from whole spleen tissue of individual mice and CD209a expression was assessed by qRT-PCR (mRNA relative to GAPDH). Data are from one representative experiment of two. (B-J) Splenocytes were isolated from normal and 7-week infected CBA and BL/6 mice. Surface expression of CD209a was assessed by flow cytometric analysis. Splenocytes were additionally stained for cell subpopulation markers CD11c, CD19, Gr-1, and F4/80 (C-F). The percentage of each individual splenocyte subpopulation that expresses CD209a was assessed by separately gating for CD11c+, CD19+, Gr-1+, or F4/80+ cells (G-J). Data are from one representative experiment of three or four. *p<0.05, **p<0.01, ***p<0.001, NS = not significant.

Article Snippet: CBA BMDCs derived with rGM-CSF were infected with lentivirus containing CD209a- or GFP-targeted shRNA (RNAi Platform of the Broad Institute, Cambridge, MA).

Techniques: Infection, Purification, Expressing, Quantitative RT-PCR, Isolation, Staining

(A) CBA and BL/6 mice were infected with S. mansoni for 7 weeks. RNA was purified from whole liver tissue of individual mice and CD209a expression was assessed by qRT-PCR (mRNA relative to GAPDH). Data are from one representative experiment of two. (B-H) Liver granuloma cells were isolated from livers by collagenase digestion followed by Lympholyte® cell separation. Surface expression of CD209a was assessed by flow cytometric analysis. Granuloma cells were additionally stained for cell subpopulation markers CD11c, Gr-1, and F4/80 (C-E). The percentage of each individual granuloma subpopulation that expresses CD209a was assessed by separately gating for CD11c+, Gr-1+, or F4/80+ cells (F-H). Data are from one representative experiment of three. *p<0.05, **p<0.01, ***p<0.001.

Journal: Journal of immunology (Baltimore, Md. : 1950)

Article Title: CD209a Expression on Dendritic Cells is Critical for the Development of Pathogenic Th17 Cell Responses in Murine Schistosomiasis 1

doi: 10.4049/jimmunol.1400121

Figure Lengend Snippet: (A) CBA and BL/6 mice were infected with S. mansoni for 7 weeks. RNA was purified from whole liver tissue of individual mice and CD209a expression was assessed by qRT-PCR (mRNA relative to GAPDH). Data are from one representative experiment of two. (B-H) Liver granuloma cells were isolated from livers by collagenase digestion followed by Lympholyte® cell separation. Surface expression of CD209a was assessed by flow cytometric analysis. Granuloma cells were additionally stained for cell subpopulation markers CD11c, Gr-1, and F4/80 (C-E). The percentage of each individual granuloma subpopulation that expresses CD209a was assessed by separately gating for CD11c+, Gr-1+, or F4/80+ cells (F-H). Data are from one representative experiment of three. *p<0.05, **p<0.01, ***p<0.001.

Article Snippet: CBA BMDCs derived with rGM-CSF were infected with lentivirus containing CD209a- or GFP-targeted shRNA (RNAi Platform of the Broad Institute, Cambridge, MA).

Techniques: Infection, Purification, Expressing, Quantitative RT-PCR, Isolation, Staining

CBA and BL/6 mice were infected for 7 weeks. OCT-embedded frozen spleen (A-D) and liver (E-F) cryostat sections were stained for CD209a (red) and imaged by confocal microscopy. CBA (A,C) and BL/6 (B,D) spleen sections were counterstained for CD11c (green) and B220 (blue). Panels A-D demonstrate CD209a localization in spleens from CBA and BL/6 mice. Scale bars represent 200 μm for both 100× and 200× magnifications. For CD209a imaging in infected CBA (E) and BL/6 (F) livers, scale bars represent 500 μm for panoramic view and 200 μm for 100× magnifications. (G-H) Average CD209a fluorescence intensity in whole liver (E,F) and granulomas (E1,2, F1,2) was quantified by Volocity 6.0 Software (PerkinElmer). (I) A CBA liver section was stained for CD209a and CD11c to demonstrate co-localization in a granuloma after merge. Scale bars represent 200μm. Images are representative of 5 mice examined per strain.

Journal: Journal of immunology (Baltimore, Md. : 1950)

Article Title: CD209a Expression on Dendritic Cells is Critical for the Development of Pathogenic Th17 Cell Responses in Murine Schistosomiasis 1

doi: 10.4049/jimmunol.1400121

Figure Lengend Snippet: CBA and BL/6 mice were infected for 7 weeks. OCT-embedded frozen spleen (A-D) and liver (E-F) cryostat sections were stained for CD209a (red) and imaged by confocal microscopy. CBA (A,C) and BL/6 (B,D) spleen sections were counterstained for CD11c (green) and B220 (blue). Panels A-D demonstrate CD209a localization in spleens from CBA and BL/6 mice. Scale bars represent 200 μm for both 100× and 200× magnifications. For CD209a imaging in infected CBA (E) and BL/6 (F) livers, scale bars represent 500 μm for panoramic view and 200 μm for 100× magnifications. (G-H) Average CD209a fluorescence intensity in whole liver (E,F) and granulomas (E1,2, F1,2) was quantified by Volocity 6.0 Software (PerkinElmer). (I) A CBA liver section was stained for CD209a and CD11c to demonstrate co-localization in a granuloma after merge. Scale bars represent 200μm. Images are representative of 5 mice examined per strain.

Article Snippet: CBA BMDCs derived with rGM-CSF were infected with lentivirus containing CD209a- or GFP-targeted shRNA (RNAi Platform of the Broad Institute, Cambridge, MA).

Techniques: Infection, Staining, Confocal Microscopy, Imaging, Fluorescence, Software

CBA BMDCs were differentiated in rGM-CSF-containing medium over 10 days. shRNA delivered by a lentiviral vector was used to knock down CD209a expression (shCD209a). Infected DCs were enriched by puromycin-selection and CD209a knockdown efficiency was assessed by flow cytometric analysis relative to CBA BMDCs receiving a GFP-targeted control shRNA (shCTRL) or normal BMDCs (A,B). CD209a expression knockdown was also assessed by qRT-PCR (mRNA relative to GAPDH) (C). (D-F) Normal CBA, shCTRL, or shCD209a DCs were co-cultured with naïve CBA CD4+ T cells and anti-CD3/CD28-coated beads ± schistosome eggs for 96 hr. IL-1β, IL-23, and IL-17 in supernatants was assessed by ELISA. Il17a (G) was assessed by qRT-PCR. (H) Normal CBA, shCTRL, or shCD209a DCs were co-cultured with S. mansoni major egg Ag Sm-p40-specific Tg T cells (Tg T) ± schistosome eggs. IL-17 was assessed by ELISA. (I-K) Transcription factors Rorc, Tbx21, and Gata3 were assessed by qRT-PCR in egg-stimulated co-cultures. Bars represent the mean ± S.D. of three biological replicates of one representative experiment of five. *p<0.05, **p<0.01, ***p<0.001, NS = not significant.

Journal: Journal of immunology (Baltimore, Md. : 1950)

Article Title: CD209a Expression on Dendritic Cells is Critical for the Development of Pathogenic Th17 Cell Responses in Murine Schistosomiasis 1

doi: 10.4049/jimmunol.1400121

Figure Lengend Snippet: CBA BMDCs were differentiated in rGM-CSF-containing medium over 10 days. shRNA delivered by a lentiviral vector was used to knock down CD209a expression (shCD209a). Infected DCs were enriched by puromycin-selection and CD209a knockdown efficiency was assessed by flow cytometric analysis relative to CBA BMDCs receiving a GFP-targeted control shRNA (shCTRL) or normal BMDCs (A,B). CD209a expression knockdown was also assessed by qRT-PCR (mRNA relative to GAPDH) (C). (D-F) Normal CBA, shCTRL, or shCD209a DCs were co-cultured with naïve CBA CD4+ T cells and anti-CD3/CD28-coated beads ± schistosome eggs for 96 hr. IL-1β, IL-23, and IL-17 in supernatants was assessed by ELISA. Il17a (G) was assessed by qRT-PCR. (H) Normal CBA, shCTRL, or shCD209a DCs were co-cultured with S. mansoni major egg Ag Sm-p40-specific Tg T cells (Tg T) ± schistosome eggs. IL-17 was assessed by ELISA. (I-K) Transcription factors Rorc, Tbx21, and Gata3 were assessed by qRT-PCR in egg-stimulated co-cultures. Bars represent the mean ± S.D. of three biological replicates of one representative experiment of five. *p<0.05, **p<0.01, ***p<0.001, NS = not significant.

Article Snippet: CBA BMDCs derived with rGM-CSF were infected with lentivirus containing CD209a- or GFP-targeted shRNA (RNAi Platform of the Broad Institute, Cambridge, MA).

Techniques: shRNA, Plasmid Preparation, Knockdown, Expressing, Infection, Selection, Control, Quantitative RT-PCR, Cell Culture, Enzyme-linked Immunosorbent Assay

BL/6 BMDCs were differentiated in rGM-CSF-containing medium over 10 days. CD209a over-expression was achieved using a lentiviral vector and confirmed by flow cytometric analysis relative to BL/6 control BMDCs that over-expressed RFP (CTRL) or normal BMDCs (A,B). CD209a over-expression was also assessed by qRT-PCR (mRNA relative to GAPDH) (C). (D-F) Normal BL/6, CTRL, or CD209a DCs were co-cultured with naïve BL/6 CD4+ T cells and anti-CD3/CD28-coated beads ± schistosome eggs for 96 hr. IL-1β, IL-23, and IL-17 in supernatants was assessed by ELISA. Il17a was assessed by qRT-PCR (G). (H-J) Transcription factors Rorc, Tbx21, and Gata3 were assessed by qRT-PCR in egg-stimulated co-cultures. Bars represent the mean ± S.D of three biological replicates of one experiment representative of three. *p<0.05, **p<0.01, ***p<0.001, NS = not significant.

Journal: Journal of immunology (Baltimore, Md. : 1950)

Article Title: CD209a Expression on Dendritic Cells is Critical for the Development of Pathogenic Th17 Cell Responses in Murine Schistosomiasis 1

doi: 10.4049/jimmunol.1400121

Figure Lengend Snippet: BL/6 BMDCs were differentiated in rGM-CSF-containing medium over 10 days. CD209a over-expression was achieved using a lentiviral vector and confirmed by flow cytometric analysis relative to BL/6 control BMDCs that over-expressed RFP (CTRL) or normal BMDCs (A,B). CD209a over-expression was also assessed by qRT-PCR (mRNA relative to GAPDH) (C). (D-F) Normal BL/6, CTRL, or CD209a DCs were co-cultured with naïve BL/6 CD4+ T cells and anti-CD3/CD28-coated beads ± schistosome eggs for 96 hr. IL-1β, IL-23, and IL-17 in supernatants was assessed by ELISA. Il17a was assessed by qRT-PCR (G). (H-J) Transcription factors Rorc, Tbx21, and Gata3 were assessed by qRT-PCR in egg-stimulated co-cultures. Bars represent the mean ± S.D of three biological replicates of one experiment representative of three. *p<0.05, **p<0.01, ***p<0.001, NS = not significant.

Article Snippet: CBA BMDCs derived with rGM-CSF were infected with lentivirus containing CD209a- or GFP-targeted shRNA (RNAi Platform of the Broad Institute, Cambridge, MA).

Techniques: Over Expression, Plasmid Preparation, Control, Quantitative RT-PCR, Cell Culture, Enzyme-linked Immunosorbent Assay

The effects of FIGL-1 overexpression. (A) NIH-3T3 cells were transfected with plasmids to overexpress GFP or GFP-FIGL-1 for 24 h, serum-starved for 24 h to induce the formation of primary cilia, and stained for acetylated tubulin (Ac-tub, magenta), pericentrin (PCNT, red) and DNA (blue). Scale bar: 7.5 μm. (B) The percentage of ciliated NIH-3T3 cells is reduced by overexpression of FIGL-1. Error bars represent the standard deviation. (C) HEK293T cells overexpressing GFP were immunostained for pericentrin (PCNT, red) and DNA (blue). Scale bar: 10 μm. (D and E) HEK293T cells were transfected with a GFP-FIGL-1-expressing vector for 24 h and immunostained for pericentrin (PCNT, red) and DNA (blue). FIGL-1 at a low expression level colocalizes with pericentrin (panel D, scale bar: 5 μm), but no pericentrin staining is observed in cells with a high expression level of FIGL-1 (panel E, scale bar: 10 μm). (F) HEK293T cells overexpressing GFP-FIGL-1 were immunostained for centrin (red) and DNA (blue). Scale bar: 7.5 μm. (G) HEK293T cells overexpressing GFP-FIGL-1 were immunostained for CP110 (red) and DNA (blue). Scale bar: 10 μm.

Journal: Cell Cycle

Article Title: Fidgetin-like 1 is a ciliogenesis-inhibitory centrosome protein

doi: 10.1080/15384101.2016.1204059

Figure Lengend Snippet: The effects of FIGL-1 overexpression. (A) NIH-3T3 cells were transfected with plasmids to overexpress GFP or GFP-FIGL-1 for 24 h, serum-starved for 24 h to induce the formation of primary cilia, and stained for acetylated tubulin (Ac-tub, magenta), pericentrin (PCNT, red) and DNA (blue). Scale bar: 7.5 μm. (B) The percentage of ciliated NIH-3T3 cells is reduced by overexpression of FIGL-1. Error bars represent the standard deviation. (C) HEK293T cells overexpressing GFP were immunostained for pericentrin (PCNT, red) and DNA (blue). Scale bar: 10 μm. (D and E) HEK293T cells were transfected with a GFP-FIGL-1-expressing vector for 24 h and immunostained for pericentrin (PCNT, red) and DNA (blue). FIGL-1 at a low expression level colocalizes with pericentrin (panel D, scale bar: 5 μm), but no pericentrin staining is observed in cells with a high expression level of FIGL-1 (panel E, scale bar: 10 μm). (F) HEK293T cells overexpressing GFP-FIGL-1 were immunostained for centrin (red) and DNA (blue). Scale bar: 7.5 μm. (G) HEK293T cells overexpressing GFP-FIGL-1 were immunostained for CP110 (red) and DNA (blue). Scale bar: 10 μm.

Article Snippet: GFP-expressing shRNA plasmids of control shRNA and FIGL-1-targeted shRNAs were ordered from Genechem (Shanghai) Ltd.

Techniques: Over Expression, Transfection, Staining, Standard Deviation, Expressing, Plasmid Preparation

The mechanism underlying FIGL-1 function in ciliogenesis. (A) ARPE19 cells were transfected with the GFP-FIGL-1-expressing plasmid for 24 h and then immunostained for acetylated tubulin (Ac-tub, red) and DNA (blue). For staining in (A) and (B), cells were fixed with cold methanol for only 3 min so that both cytoplasmic microtubules and centrosomes could be stained. Scale bar: 10 μm. (B) ARPE19 cells were transfected with the GFP-FIGL-1-Nter-expressing plasmid for 24 h and then immunostained for acetylated tubulin (Ac-tub, red) and DNA (blue). Scale bar: 10 μm. (C) HEK293T cells were transfected with the GFP-FIGL-1-Nter-expressing plasmid for 24 h, serum-starved for 24 h to induce the formation of primary cilia, and then immunostained for acetylated tubulin (Ac-tub, red) and DNA (blue). Scale bar: 7.5 μm. (D) Percentages of ciliated HEK293T cells overexpressing GFP, GFP-FIGL-1, or GFP-FIGL-1-Nter after serum starvation for 24 h. (E) The relative amount of endogenous FIGL-1 protein of ARPE19 cells at different stages was detected by protein gel blotting. G0 stage cells were obtained by serum starvation for 24 h. Cells were synchronized in G1, S, G2, and M phase cells as described in the Methods. Control cells were not treated. The normalized relative amount of FIGL-1 protein is given below the gel.

Journal: Cell Cycle

Article Title: Fidgetin-like 1 is a ciliogenesis-inhibitory centrosome protein

doi: 10.1080/15384101.2016.1204059

Figure Lengend Snippet: The mechanism underlying FIGL-1 function in ciliogenesis. (A) ARPE19 cells were transfected with the GFP-FIGL-1-expressing plasmid for 24 h and then immunostained for acetylated tubulin (Ac-tub, red) and DNA (blue). For staining in (A) and (B), cells were fixed with cold methanol for only 3 min so that both cytoplasmic microtubules and centrosomes could be stained. Scale bar: 10 μm. (B) ARPE19 cells were transfected with the GFP-FIGL-1-Nter-expressing plasmid for 24 h and then immunostained for acetylated tubulin (Ac-tub, red) and DNA (blue). Scale bar: 10 μm. (C) HEK293T cells were transfected with the GFP-FIGL-1-Nter-expressing plasmid for 24 h, serum-starved for 24 h to induce the formation of primary cilia, and then immunostained for acetylated tubulin (Ac-tub, red) and DNA (blue). Scale bar: 7.5 μm. (D) Percentages of ciliated HEK293T cells overexpressing GFP, GFP-FIGL-1, or GFP-FIGL-1-Nter after serum starvation for 24 h. (E) The relative amount of endogenous FIGL-1 protein of ARPE19 cells at different stages was detected by protein gel blotting. G0 stage cells were obtained by serum starvation for 24 h. Cells were synchronized in G1, S, G2, and M phase cells as described in the Methods. Control cells were not treated. The normalized relative amount of FIGL-1 protein is given below the gel.

Article Snippet: GFP-expressing shRNA plasmids of control shRNA and FIGL-1-targeted shRNAs were ordered from Genechem (Shanghai) Ltd.

Techniques: Transfection, Expressing, Plasmid Preparation, Staining

The effects of FIGL-1 overexpression in zebrafish embryos. (A) Representative fluorescent images of Kupffer's Vesicle (KV) from GFP- or GFP-FIGL-1-overexpressing embryos, stained with an antibody against acetylated tubulin (Ac-tub, red). Scale Bar: 10 μm. Bar graph shows the average cilium length in GFP- or GFP-FIGL-1-overexpressing embryos. ‘n’ indicates the number of embryos pooled from 2 independent experiments. (B) Representative bright-field images showing the heart position in zebrafish embryos at 30 hpf. The embryos are shown in ventral view, showing typical left-, middle- or right-positioned heart as indicated. Bar graph shows the distribution of heart position in GFP- or GFP-FIGL-1-overexpressing embryos. ‘n’ indicates the number of embryos pooled from 3 independent experiments. (C) Representative bright-field images showing the expression pattern of southpaw in the left, bilateral or right lateral plate as indicated. Embryos are shown in dorsal view. Bar graph shows the distribution of southpaw in GFP- or GFP-FIGL-1-overexpressing embryos. ‘n’ indicates the number of embryos pooled from 3 independent experiments. In this figure, *: 0.01≤p<0. 05, **: 0.005≤p<0.01, ***: p<0.005.

Journal: Cell Cycle

Article Title: Fidgetin-like 1 is a ciliogenesis-inhibitory centrosome protein

doi: 10.1080/15384101.2016.1204059

Figure Lengend Snippet: The effects of FIGL-1 overexpression in zebrafish embryos. (A) Representative fluorescent images of Kupffer's Vesicle (KV) from GFP- or GFP-FIGL-1-overexpressing embryos, stained with an antibody against acetylated tubulin (Ac-tub, red). Scale Bar: 10 μm. Bar graph shows the average cilium length in GFP- or GFP-FIGL-1-overexpressing embryos. ‘n’ indicates the number of embryos pooled from 2 independent experiments. (B) Representative bright-field images showing the heart position in zebrafish embryos at 30 hpf. The embryos are shown in ventral view, showing typical left-, middle- or right-positioned heart as indicated. Bar graph shows the distribution of heart position in GFP- or GFP-FIGL-1-overexpressing embryos. ‘n’ indicates the number of embryos pooled from 3 independent experiments. (C) Representative bright-field images showing the expression pattern of southpaw in the left, bilateral or right lateral plate as indicated. Embryos are shown in dorsal view. Bar graph shows the distribution of southpaw in GFP- or GFP-FIGL-1-overexpressing embryos. ‘n’ indicates the number of embryos pooled from 3 independent experiments. In this figure, *: 0.01≤p<0. 05, **: 0.005≤p<0.01, ***: p<0.005.

Article Snippet: GFP-expressing shRNA plasmids of control shRNA and FIGL-1-targeted shRNAs were ordered from Genechem (Shanghai) Ltd.

Techniques: Over Expression, Staining, Expressing